ID: 1035165486_1035165496

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1035165486 1035165496
Species Human (GRCh38) Human (GRCh38)
Location 7:156987091-156987113 7:156987134-156987156
Sequence CCACAGTACAAGTGTGCAGAAGT AGGGACAGGGCAATAGGGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 55, 4: 575}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!