ID: 1035167574_1035167589

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1035167574 1035167589
Species Human (GRCh38) Human (GRCh38)
Location 7:157000542-157000564 7:157000575-157000597
Sequence CCCTCCAAGCCTGGGGCGCACTC TCCGCTGGCGGGGGCGGGGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 9, 3: 166, 4: 1077}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!