ID: 1035169534_1035169543

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1035169534 1035169543
Species Human (GRCh38) Human (GRCh38)
Location 7:157009939-157009961 7:157009952-157009974
Sequence CCAGGCCCCCAGCGGCGGCGGCG GGCGGCGGCGGCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 97, 4: 520} {0: 1025, 1: 1397, 2: 2293, 3: 4170, 4: 7329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!