ID: 1035201238_1035201241

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1035201238 1035201241
Species Human (GRCh38) Human (GRCh38)
Location 7:157268098-157268120 7:157268111-157268133
Sequence CCTGAGCAGGCAGCGCCACTCCA CGCCACTCCAGGGTTCAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 168} {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!