ID: 1035209723_1035209730

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1035209723 1035209730
Species Human (GRCh38) Human (GRCh38)
Location 7:157318850-157318872 7:157318882-157318904
Sequence CCATGTCCCGGCTGGGCACGGTG TGTAATCCCAGCACTTTGGGAGG
Strand - +
Off-target summary No data {0: 288135, 1: 266162, 2: 155564, 3: 133776, 4: 191789}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!