ID: 1035212068_1035212073

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1035212068 1035212073
Species Human (GRCh38) Human (GRCh38)
Location 7:157336390-157336412 7:157336404-157336426
Sequence CCCTGGCGAAGTCTCCACGCGCT CCACGCGCTCCCGTTCGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 29} {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!