ID: 1035223999_1035224006

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1035223999 1035224006
Species Human (GRCh38) Human (GRCh38)
Location 7:157423774-157423796 7:157423796-157423818
Sequence CCTGCAGCCCACACTGGCTGTGG GACAGAGCAGGGTGCCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 328} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!