ID: 1035243657_1035243668

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1035243657 1035243668
Species Human (GRCh38) Human (GRCh38)
Location 7:157548550-157548572 7:157548595-157548617
Sequence CCTCCACAAAGCGCAGGCCCCGG AGCTCAGAACATCCTCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 139} {0: 1, 1: 0, 2: 3, 3: 13, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!