ID: 1035248244_1035248256

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1035248244 1035248256
Species Human (GRCh38) Human (GRCh38)
Location 7:157579604-157579626 7:157579655-157579677
Sequence CCCCGTCGACTGGGGGGACCCGG TCGCGTCCGCCCTTCATTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 29} {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!