ID: 1035268640_1035268643 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1035268640 | 1035268643 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:157706510-157706532 | 7:157706535-157706557 |
| Sequence | CCTCTAGAATGCCGGGAACTGAG | AATCTGACCCAGGTGCCTTCTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 8, 1: 2, 2: 1, 3: 12, 4: 124} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||