ID: 1035270135_1035270148

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1035270135 1035270148
Species Human (GRCh38) Human (GRCh38)
Location 7:157714949-157714971 7:157714989-157715011
Sequence CCCGCTTTCCGAGGCCAGCTCCC CCCCATGTGCTTTTCCTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!