ID: 1035270519_1035270521

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1035270519 1035270521
Species Human (GRCh38) Human (GRCh38)
Location 7:157717167-157717189 7:157717200-157717222
Sequence CCAAAATCGATCCACGAGGCTTT ATCTCTAAAAAAAGCACATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33} {0: 1, 1: 0, 2: 3, 3: 41, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!