ID: 1035271128_1035271137

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1035271128 1035271137
Species Human (GRCh38) Human (GRCh38)
Location 7:157720560-157720582 7:157720599-157720621
Sequence CCCGGCTGCACCGATGCATGGGT AGGGAGTCACGTGAATCATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 29, 4: 690}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!