ID: 1035283116_1035283118

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1035283116 1035283118
Species Human (GRCh38) Human (GRCh38)
Location 7:157789543-157789565 7:157789556-157789578
Sequence CCTGACAACAAGGGAATTCAGCC GAATTCAGCCACACACCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117} {0: 1, 1: 0, 2: 1, 3: 61, 4: 556}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!