ID: 1035293176_1035293183

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1035293176 1035293183
Species Human (GRCh38) Human (GRCh38)
Location 7:157853059-157853081 7:157853076-157853098
Sequence CCGTCCTCTCTCCGCCTCCAGAT CCAGATCAGCAGGCAGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 625} {0: 1, 1: 1, 2: 1, 3: 33, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!