ID: 1035293177_1035293183

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1035293177 1035293183
Species Human (GRCh38) Human (GRCh38)
Location 7:157853063-157853085 7:157853076-157853098
Sequence CCTCTCTCCGCCTCCAGATCAGC CCAGATCAGCAGGCAGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 99, 4: 2456} {0: 1, 1: 1, 2: 1, 3: 33, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!