ID: 1035303263_1035303268

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1035303263 1035303268
Species Human (GRCh38) Human (GRCh38)
Location 7:157911851-157911873 7:157911887-157911909
Sequence CCTTCCGTCTTCTGCTAACCCTG AGATTCGGTTTTGCATGTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 170} {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!