ID: 1035310953_1035310959

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1035310953 1035310959
Species Human (GRCh38) Human (GRCh38)
Location 7:157968515-157968537 7:157968529-157968551
Sequence CCAGCCTCCTTCTGTTTTTCCAG TTTTTCCAGGGGATCTAACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 660} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!