ID: 1035317520_1035317523

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1035317520 1035317523
Species Human (GRCh38) Human (GRCh38)
Location 7:158006092-158006114 7:158006112-158006134
Sequence CCTTCTTGGGGCACCTGCTGCCC CCCCTTCCTCCTGCCTCTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 16, 3: 161, 4: 1023}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!