ID: 1035326260_1035326265

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1035326260 1035326265
Species Human (GRCh38) Human (GRCh38)
Location 7:158067983-158068005 7:158068001-158068023
Sequence CCTGTGGGGTGGCATGGACCTTG CCTTGCAGCTGGGAGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 228} {0: 1, 1: 0, 2: 7, 3: 37, 4: 472}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!