ID: 1035329568_1035329572

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1035329568 1035329572
Species Human (GRCh38) Human (GRCh38)
Location 7:158087557-158087579 7:158087575-158087597
Sequence CCCACTCAGATGCAAACGCTTCC CTTCCTCCCCTGACGAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95} {0: 1, 1: 6, 2: 24, 3: 34, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!