ID: 1035329576_1035329577

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1035329576 1035329577
Species Human (GRCh38) Human (GRCh38)
Location 7:158087583-158087605 7:158087609-158087631
Sequence CCTGACGAAGGAGGGAGTCTTCA AAACCTTCCTCCCCTGATGAAGG
Strand - +
Off-target summary No data {0: 2, 1: 7, 2: 0, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!