ID: 1035339395_1035339404

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1035339395 1035339404
Species Human (GRCh38) Human (GRCh38)
Location 7:158150865-158150887 7:158150915-158150937
Sequence CCAACCCAACGTGCTGGTGGAAT CCCACACAACACCGAGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!