ID: 1035344384_1035344400

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1035344384 1035344400
Species Human (GRCh38) Human (GRCh38)
Location 7:158188605-158188627 7:158188641-158188663
Sequence CCCGCCACGCTCGCCCCCTGATG CGCTCGCCCCCTGATGGGGAAGG
Strand - +
Off-target summary No data {0: 5, 1: 4, 2: 2, 3: 4, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!