ID: 1035355256_1035355259

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1035355256 1035355259
Species Human (GRCh38) Human (GRCh38)
Location 7:158272794-158272816 7:158272807-158272829
Sequence CCATCGGGGAGGTGCCGCCGGCA GCCGCCGGCAGAAGGAGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!