ID: 1035369736_1035369750

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1035369736 1035369750
Species Human (GRCh38) Human (GRCh38)
Location 7:158372244-158372266 7:158372277-158372299
Sequence CCTCCCCAGTGCTGGTCCCCAGA CCAACGCTGGTCCCCGGAGCTGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 4, 3: 11, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!