|
Left Crispr |
Right Crispr |
| Crispr ID |
1035380733 |
1035380739 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:158438987-158439009
|
7:158439037-158439059
|
| Sequence |
CCTATTGCTTATGTAAAAATGCA |
ATTCACTGGAAGGCTGGTCAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 66, 2: 92, 3: 103, 4: 345} |
{0: 1, 1: 2, 2: 34, 3: 89, 4: 241} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|