ID: 1035380735_1035380739

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1035380735 1035380739
Species Human (GRCh38) Human (GRCh38)
Location 7:158439021-158439043 7:158439037-158439059
Sequence CCAGGCTCAATTGTGTATTCACT ATTCACTGGAAGGCTGGTCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 34, 3: 89, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!