ID: 1035380765_1035380778

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1035380765 1035380778
Species Human (GRCh38) Human (GRCh38)
Location 7:158439246-158439268 7:158439290-158439312
Sequence CCGTCCACCTCCTGCGCATGCCT ACAAGTCTCAGGACTTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 340} {0: 1, 1: 15, 2: 16, 3: 32, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!