ID: 1035392347_1035392350

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1035392347 1035392350
Species Human (GRCh38) Human (GRCh38)
Location 7:158513258-158513280 7:158513282-158513304
Sequence CCAGGGGACATTCTACAGACTGA CAGGCCTCCTCAAAACTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113} {0: 1, 1: 5, 2: 13, 3: 36, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!