ID: 1035404270_1035404290

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1035404270 1035404290
Species Human (GRCh38) Human (GRCh38)
Location 7:158587851-158587873 7:158587903-158587925
Sequence CCCGGCGGCAGGGCCCCGCCCCC CCGGCCAGCCCCGCTCGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 84, 4: 608} {0: 1, 1: 2, 2: 65, 3: 278, 4: 660}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!