ID: 1035404271_1035404290

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1035404271 1035404290
Species Human (GRCh38) Human (GRCh38)
Location 7:158587852-158587874 7:158587903-158587925
Sequence CCGGCGGCAGGGCCCCGCCCCCG CCGGCCAGCCCCGCTCGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 69, 4: 539} {0: 1, 1: 2, 2: 65, 3: 278, 4: 660}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!