ID: 1035412040_1035412044

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1035412040 1035412044
Species Human (GRCh38) Human (GRCh38)
Location 7:158652269-158652291 7:158652288-158652310
Sequence CCCGTCCTGGGGAGTTCTGAGTA AGTACCCGCAGGCCTTCTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 172} {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!