ID: 1035414074_1035414088

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1035414074 1035414088
Species Human (GRCh38) Human (GRCh38)
Location 7:158668204-158668226 7:158668237-158668259
Sequence CCTCCGCCCCCCCTTACCCACTA CTGCCCTCCTTACCCACTACTGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 1, 3: 33, 4: 321} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!