ID: 1035414095_1035414105

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1035414095 1035414105
Species Human (GRCh38) Human (GRCh38)
Location 7:158668262-158668284 7:158668295-158668317
Sequence CCCTCTGCCCTCCTTACCTACCT GGCCCTCCCTTACCCACTACTGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 4, 3: 9, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!