ID: 1035414095_1035414106

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1035414095 1035414106
Species Human (GRCh38) Human (GRCh38)
Location 7:158668262-158668284 7:158668296-158668318
Sequence CCCTCTGCCCTCCTTACCTACCT GCCCTCCCTTACCCACTACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 85, 4: 1460} {0: 6, 1: 3, 2: 0, 3: 12, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!