ID: 1035419108_1035419113

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1035419108 1035419113
Species Human (GRCh38) Human (GRCh38)
Location 7:158712188-158712210 7:158712220-158712242
Sequence CCTGGGTGGTGCCACAGGGCAGA TAAAGGCTTCCTAAGGGTCGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 323} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!