ID: 1035430687_1035430695

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1035430687 1035430695
Species Human (GRCh38) Human (GRCh38)
Location 7:158818513-158818535 7:158818553-158818575
Sequence CCATTTCAGCAGAGGTGGGGGAG CACCAGGACTTGCCTGCAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 231} {0: 1, 1: 0, 2: 1, 3: 17, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!