ID: 1035435550_1035435563

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1035435550 1035435563
Species Human (GRCh38) Human (GRCh38)
Location 7:158856699-158856721 7:158856729-158856751
Sequence CCGAGGACACCGCGGCCGCCCGG GGAAGCGATGGAGCCCGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 204} {0: 1, 1: 0, 2: 0, 3: 25, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!