ID: 1035435550_1035435571

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1035435550 1035435571
Species Human (GRCh38) Human (GRCh38)
Location 7:158856699-158856721 7:158856751-158856773
Sequence CCGAGGACACCGCGGCCGCCCGG GTCGGTGCGGCGCTGGGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 204} {0: 1, 1: 0, 2: 1, 3: 8, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!