ID: 1035441082_1035441087

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1035441082 1035441087
Species Human (GRCh38) Human (GRCh38)
Location 7:158900667-158900689 7:158900696-158900718
Sequence CCATCCCCATTATACATGTGAAT TGCAGTTGTCCCACAGTTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 229} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!