ID: 1035447070_1035447076

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1035447070 1035447076
Species Human (GRCh38) Human (GRCh38)
Location 7:158950372-158950394 7:158950409-158950431
Sequence CCAGGTGTGAGCACCAGGACCAG CAGGTGTTCTATATGATTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 247} {0: 9, 1: 0, 2: 1, 3: 10, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!