ID: 1035459352_1035459361

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1035459352 1035459361
Species Human (GRCh38) Human (GRCh38)
Location 7:159029724-159029746 7:159029762-159029784
Sequence CCCCTCCTTCATGACCTTGCTCT TCCTCAGCCCGCCTTCCGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 463} {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!