ID: 1035459357_1035459361

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1035459357 1035459361
Species Human (GRCh38) Human (GRCh38)
Location 7:159029738-159029760 7:159029762-159029784
Sequence CCTTGCTCTCCTGATCTGGTTGT TCCTCAGCCCGCCTTCCGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 212} {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!