ID: 1035459609_1035459625

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1035459609 1035459625
Species Human (GRCh38) Human (GRCh38)
Location 7:159030883-159030905 7:159030935-159030957
Sequence CCCGCCTGCTCCCGTATCTGTGT CCTTGGGGGCAGAGGCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 172} {0: 1, 1: 0, 2: 6, 3: 108, 4: 1121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!