ID: 1035459612_1035459625

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1035459612 1035459625
Species Human (GRCh38) Human (GRCh38)
Location 7:159030893-159030915 7:159030935-159030957
Sequence CCCGTATCTGTGTTGCCAGCAGA CCTTGGGGGCAGAGGCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 134} {0: 1, 1: 0, 2: 6, 3: 108, 4: 1121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!