ID: 1035466830_1035466835

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1035466830 1035466835
Species Human (GRCh38) Human (GRCh38)
Location 7:159084762-159084784 7:159084779-159084801
Sequence CCACCCCTCACTGGAGGCCGCCA CCGCCAGTTGCCAGTCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 212} {0: 1, 1: 0, 2: 1, 3: 8, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!