ID: 1035470410_1035470420

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1035470410 1035470420
Species Human (GRCh38) Human (GRCh38)
Location 7:159105622-159105644 7:159105666-159105688
Sequence CCGACACCATCACCAATCAGGGG CTCACACAGGGAGCCCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 130} {0: 1, 1: 0, 2: 1, 3: 35, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!