ID: 1035472212_1035472218

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1035472212 1035472218
Species Human (GRCh38) Human (GRCh38)
Location 7:159117687-159117709 7:159117703-159117725
Sequence CCACAGAGAGTGGCAGCTGAGGG CTGAGGGTGGGTGGCCCAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 33, 4: 490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!