ID: 1035477511_1035477518

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1035477511 1035477518
Species Human (GRCh38) Human (GRCh38)
Location 7:159153653-159153675 7:159153667-159153689
Sequence CCTCAGCCCCTCCAGGTGGGGAC GGTGGGGACGAGGAGGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 365} {0: 1, 1: 0, 2: 10, 3: 145, 4: 1168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!